extended read me file
[pid.git] / configFile.py
1 ###
2 # Configuration parameters for: p1_trim_and_filter
3 ###
4
5 #######
6 # 454 #
7 #######
8 cfg={
9 'runid':'454_subsample',
10 'p5_virus_match':'GTAGCATGACAAAAATCTTAGAGCC',
11 'p3_virus_match':'CATTRCTTTGGATGGGTATGAA',
12 'barcodes':['ACG','CGT','TAC'],
13 # 'input_data_file':'../data/rawdata_reg2.fsa',
14 'input_data_file':'data/subsample.fasta',
15 'p5_cutoff': 21,#=len(p5_virus_match)-4
16 'p3_cutoff': 18,#=len(p3_virus_match)-4
17 'min_occ_same_pid':1,
18 'min_length_pid':10,
19 'reverse':True,
20 'barcode_length_range':range(3,5)
21 }
22
23 ##############
24 # iontorrent #
25 ##############
26 #cfg={
27 # 'runid':'2013-09-23-Run1',
28 # 'p5_virus_match':'TGGCAGTCTAGCAGAAGAAG',
29 # 'p3_virus_match':'CCTCAGGAGGGGACCCAG',
30 # 'barcodes':['TACG','ACGT','CGTA','GTAC'],
31 # 'input_data_file':'data/subsample_iontorrent.fastq',
32 # 'reverse':False,
33 # 'min_occ_same_pid':1,
34 # 'min_length_pid':8,
35 # 'barcode_length_range':range(3,5)
36 #}
37 #