869713a457ea82d9a5576227537fe8ba6c25095c
[qpalma.git] / tests / test_data / chr1.dna.flat
1 acgtacgtagcgatctgctcgtacgtgctcgatcaggcagtczzuuctgt