+ fixed minor bugs
[qpalma.git] / tests / test_qpalma.py
1 #!/usr/bin/env python
2 # -*- coding: utf-8 -*-
4 # This program is free software; you can redistribute it and/or modify
5 # it under the terms of the GNU General Public License as published by
6 # the Free Software Foundation; either version 2 of the License, or
7 # (at your option) any later version.
8 #
9 # Written (W) 2008 Fabio De Bona
10 # Copyright (C) 2008 Max-Planck-Society
13 import cPickle
14 import random
15 import math
16 import numpy
17 from numpy import inf
18 import os.path
19 import pdb
20 import array
21 import unittest
23 from qpalma.qpalma_main import QPalma
24 from qpalma.utils import print_prediction
26 from qpalma.Run import Run
28 from qpalma.SettingsParser import parseSettings
29 from qpalma.OutputFormat import alignment_reconstruct
30 from qpalma.sequence_utils import DataAccessWrapper,SeqSpliceInfo,reverse_complement
32 from qpalma.Lookup import LookupTable
34 jp = os.path.join
36 pos_chr1 = 'ccctaaaccctaaaccctaaaccctaaacctctgaatccttaatccctaaatccctaaatctttaaatcctacatccatgaatccctaaatacctaattccctaaacccgaaaccggtttctctggttgaaaatcattgtgtatataatgataattttatcgtttttatgtaattgcttattgttgtgtgtagattttttaaaaatatcatttgaggtcaatacaaatcctatttcttgtggttttctttccttcacttagctatggatggtttatcttcatttgttatattggatacaagctttgctacgatctacatttgggaatgtgagtctcttattgtaaccttagggttggtttatctcaagaatcttattaattgtttggactgtttatgtttggacatttattgtcattcttactcctttgtggaaatgtttgttctatcaatttatcttttgtgggaaaattatttagttgtagggatgaagtctttcttcgttgttgttacgcttgtcatctcatctctcaatgatatgggatggtcctttagcatttat'+'x'*205
38 neg_chr1 = ''
40 acc_p = [217, 262, 302, 333, 352, 369, 478, 484, 492, 554]
41 don_p = [217, 239, 242, 261, 271, 285, 301, 306, 328, 332, 342, 353, 357, 382, 391, 397, 412, 429, 437, 441, 461, 477, 480, 491, 501, 504, 507, 512, 516, 545, 553]
43 acc_n = [229, 235, 246, 251, 256, 261, 276, 301, 306, 313, 333, 335, 346, 362, 371, 388, 417, 421, 424, 443, 455, 492, 496, 512, 520, 525, 527, 547]
44 don_n = [224, 257, 262, 298, 302, 307, 310, 317, 346, 389, 404, 422, 511, 513, 554]
47 def check_createScoresForSequence():
48 print 'Positive strand:'
49 createScoresForSequence(pos_chr1,reverse_strand=False)
50 print acc_p
51 print don_p
53 print 'Negative strand:'
54 filename = '/fml/ag-raetsch/share/projects/genomes/A_thaliana_best/genome/chr1.dna.flat.neg'
55 neg_chr1 = open(filename).read().strip()
56 print len(neg_chr1)
57 createScoresForSequence(neg_chr1,reverse_strand=True)
58 print acc_n
59 print don_n
62 def createScoresForSequence(full_chromo_seq,reverse_strand=False):
63 """
64 Given a genomic sequence this function calculates random scores for all
65 ocurring splice sites.
66 """
68 acc_pos = []
69 don_pos = []
71 total_size = len(full_chromo_seq)
73 # the first/last 205 pos do not have any predictions
74 for pos,elem in enumerate(full_chromo_seq):
75 if pos < 205 or pos > total_size-205:
76 continue
78 if full_chromo_seq[pos-2:pos] == 'ag':
79 acc_pos.append(pos)
80 if full_chromo_seq[pos:pos+2] == 'gt' or full_chromo_seq[pos:pos+2] == 'gc':
81 don_pos.append(pos)
83 acc_scores = [0.0]*len(acc_pos)
84 don_scores = [0.0]*len(don_pos)
86 for idx in range(len(acc_pos)):
87 acc_scores[idx] = random.uniform(0.1,1.0)
89 for idx in range(len(don_pos)):
90 don_scores[idx] = random.uniform(0.1,1.0)
92 # recalculate indices and reverse them in order to have positions relative
93 # to positive strand
94 if reverse_strand:
95 acc_pos = [total_size-1-e for e in acc_pos]
96 acc_pos.reverse()
97 acc_scores.reverse()
99 don_pos = [total_size-1-e for e in don_pos]
100 don_pos.reverse()
101 don_scores.reverse()
103 # make pos 1-based
104 acc_pos = [e+1 for e in acc_pos]
105 don_pos = [e+1 for e in don_pos]
107 #print acc_pos[:10]
108 #print don_pos[:10]
110 acc_pos = array.array('I',acc_pos)
111 acc_scores = array.array('f',acc_scores)
113 don_pos = array.array('I',don_pos)
114 don_scores = array.array('f',don_scores)
116 return acc_pos,acc_scores,don_pos,don_scores
119 def saveSpliceInfo(acc_pos,acc_scores,don_pos,don_scores,strand):
120 """
121 """
123 acc_score_fn = 'test_data/acc/chromo_1%s.Conf'%strand
124 acc_pos_fn = 'test_data/acc/chromo_1%s.pos'%strand
125 don_score_fn = 'test_data/don/chromo_1%s.Conf'%strand
126 don_pos_fn = 'test_data/don/chromo_1%s.pos'%strand
128 acc_scores.tofile(open(acc_score_fn, 'wb'))
129 acc_pos.tofile(open(acc_pos_fn, 'wb'))
131 don_scores.tofile(open(don_score_fn, 'wb'))
132 don_pos.tofile(open(don_pos_fn, 'wb'))
135 def create_mini_chromosome():
137 chromo_fn = 'test_data/chromo1.flat'
139 chromo_fh = open(chromo_fn)
140 full_chromo_seq = chromo_fh.read()
141 full_chromo_seq = full_chromo_seq.strip()
143 print full_chromo_seq[:200]
145 # create data for forward strand
146 acc_pos,acc_scores,don_pos,don_scores = createScoresForSequence(full_chromo_seq,reverse_strand=False)
147 print acc_pos[:5]
148 print don_pos[:5]
149 saveSpliceInfo(acc_pos,acc_scores,don_pos,don_scores,'+')
151 # create data for reverse strand
152 full_chromo_seq_rev = reverse_complement(full_chromo_seq)
154 total_size = len(full_chromo_seq_rev)
156 print full_chromo_seq_rev[:200]
157 acc_pos,acc_scores,don_pos,don_scores = createScoresForSequence(full_chromo_seq_rev,reverse_strand=True)
158 saveSpliceInfo(acc_pos,acc_scores,don_pos,don_scores,'-')
161 def test_rev_comp():
162 get_seq_and_scores(self,chromo,strand,genomicSeq_start,genomicSeq_stop,only_seq=False,perform_checks=True)
164 class TestQPalmaPrediction(unittest.TestCase):
165 """
166 This class...
167 """
170 def _setUp(self):
171 self.prediction_set = {}
173 # chr1 + 20-120
174 read = 'catctatgcaacagcattacagtgatcaccggcccaaaaaacctgtgtctggggttttgcctgatgatagcagtgatactgaaactggatcaatggtaag'
175 currentQualities = [[40]*len(read)]
177 id = 3
178 chromo = 1
179 strand = '+'
181 genomicSeq_start = 3500
182 genomicSeq_stop = 6500
183 print 'Position: ',
184 print genomicSeq_start,genomicSeq_stop
186 currentSeqInfo = id,chromo,strand,genomicSeq_start,genomicSeq_stop
188 example = (currentSeqInfo,read,currentQualities)
189 self.prediction_set[id] = [example]
191 # chr1 - 5000-5100
192 read = 'ctgtgtatctggttgctcaatatgctcgccggaaaatgaagatcatggatgctgtgagttctccttattgttcattatcaaactgatatgagtttctgat'
193 currentQualities = [[40]*len(read)]
195 id = 4
196 chromo = 1
197 strand = '-'
199 total_size = 30432563
201 genomicSeq_start = total_size - 6500
202 genomicSeq_stop = total_size - 3500
203 print 'Position: ',
204 print genomicSeq_start,genomicSeq_stop
206 currentSeqInfo = id,chromo,strand,genomicSeq_start,genomicSeq_stop
208 example = (currentSeqInfo,read,currentQualities)
209 self.prediction_set[id] = [example]
212 def testAlignments(self):
214 settings = parseSettings('testcase.conf')
216 print self.prediction_set
217 for example_key in self.prediction_set.keys():
218 print 'Current example %d' % example_key
220 for example in self.prediction_set[example_key]:
221 print example
222 print 'size'
223 print len(example)
225 accessWrapper = DataAccessWrapper(settings)
226 seqInfo = SeqSpliceInfo(accessWrapper,settings['allowed_fragments'])
228 qp = QPalma(seqInfo,True)
229 allPredictions = qp.predict(self.prediction_set,settings)
231 for current_prediction in allPredictions:
232 align_str = print_prediction(current_prediction)
233 print align_str
235 id = current_prediction['id']
236 seq = current_prediction['read']
237 dna = current_prediction['dna']
238 chromo = current_prediction['chr']
239 strand = current_prediction['strand']
240 start_pos = current_prediction['start_pos']
241 predExons = current_prediction['predExons']
243 numExons = int(math.ceil(len(predExons) / 2))
245 print alignment_reconstruct(current_prediction,numExons)
246 print id,start_pos,predExons
248 print 'Problem counter is %d' % qp.problem_ctr
251 def _testAlignments(self):
252 run_dir = '/fml/ag-raetsch/home/fabio/tmp/newest_run/alignment/saved_run'
254 run = cPickle.load(open(jp(run_dir,'run_obj.pickle')))
255 run['name'] = 'test_run'
256 run['result_dir'] = '/fml/ag-raetsch/home/fabio/tmp/sandbox/testcases'
258 param_fn = jp(run_dir,'param_526.pickle')
259 param = cPickle.load(open(param_fn))
261 print self.prediction_set
262 for example_key in self.prediction_set.keys():
263 print 'Current example %d' % example_key
265 for example in self.prediction_set[example_key]:
266 print example
267 print 'size'
268 print len(example)
270 # fetch the data needed
271 settings = {}
273 settings['genome_dir'] = '/fml/ag-raetsch/share/projects/genomes/A_thaliana_best/genome'
274 settings['acceptor_scores_loc'] = '/fml/ag-raetsch/home/fabio/tmp/interval_query_files/acc'
275 settings['donor_scores_loc'] = '/fml/ag-raetsch/home/fabio/tmp/interval_query_files/don'
277 settings['genome_file_fmt'] = 'chr%d.dna.flat'
278 settings['splice_score_file_fmt']= 'contig_%d%s'
280 allowed_fragments = [1]
281 settings['allowed_fragments'] = allowed_fragments
283 accessWrapper = DataAccessWrapper(settings)
284 seqInfo = SeqSpliceInfo(accessWrapper,allowed_fragments)
286 qp = QPalma(run,seqInfo,True)
287 allPredictions = qp.predict(self.prediction_set,param)
289 for current_prediction in allPredictions:
290 align_str = print_prediction(current_prediction)
291 print align_str
293 id = current_prediction['id']
294 seq = current_prediction['read']
295 dna = current_prediction['dna']
296 chromo = current_prediction['chr']
297 strand = current_prediction['strand']
298 start_pos = current_prediction['start_pos']
299 predExons = current_prediction['predExons']
301 numExons = int(math.ceil(len(predExons) / 2))
303 print alignment_reconstruct(current_prediction,numExons)
304 print id,start_pos,predExons
306 print 'Problem counter is %d' % qp.problem_ctr
308 def check_reverse_strand_calculation(id,b,e,seqInfo):
309 seq,acc,don = seqInfo.get_seq_and_scores(id,'-',b,e,only_seq=False,perform_checks=False)
311 total_size = seqInfo.getFragmentSize(1)
312 bp = total_size - e
313 ep = total_size - b
314 seqp,acc,don = seqInfo.get_seq_and_scores(id,'+',bp,ep,only_seq=False,perform_checks=False)
315 seqp = reverse_complement(seqp)
317 return (seq == seqp)
319 def check_example(chromo,strand,b,e,seqInfo,lt1):
320 dna,acc,don = seqInfo.get_seq_and_scores(1,strand,b,e)
322 if lt1 != None:
323 _dna,_acc,_don= lt1.get_seq_and_scores(1,strand,b,e)
324 else:
325 _dna,_acc,_don = seqInfo.get_seq_and_scores(1,strand,b,e)
327 print 'Current interval: (%d,%d), current strand: %s'%(b,e,strand)
328 print 'Results for dna,acc,don:'
329 print '%s %s %s'%(str(dna==_dna),str(acc==_acc),str(don==_don))
330 print 'size is %d' % len(dna)
331 if dna != _dna:
332 print dna[:20]
333 print _dna[:20]
335 print [p for p,e in enumerate(acc) if e != -inf][:10]
336 print [p for p,e in enumerate(_acc) if e != -inf][:10]
337 print [p for p,e in enumerate(don) if e != -inf][:10]
338 print [p for p,e in enumerate(_don) if e != -inf][:10]
341 def simple_check(settings,seqInfo,lt1):
343 print 'Checking sequences for some intervals...'
345 intervals = [(0,10000),(545,874),(999,1234)]
347 chromo = 1
348 total_size = seqInfo.getFragmentSize(chromo)
350 for strand in ['+','-']:
351 for (b,e) in [(206,874),(545,874),(999,1234),(1000,total_size-1000),(3,total_size-3),(0,total_size)]:
352 check_example(chromo,strand,b,e,seqInfo,lt1)
354 for (b,e) in intervals:
355 print 'Rev strand calculation: %s'%str(check_reverse_strand_calculation(1,b,e,seqInfo))
358 def checks():
359 settings = {}
361 settings['genome_dir'] = 'test_data/'
362 settings['acceptor_scores_loc'] = 'test_data/acc'
363 settings['donor_scores_loc'] = 'test_data/don'
365 settings['genome_file_fmt'] = 'chromo%d.flat'
366 settings['splice_score_file_fmt']= 'chromo_%d%s'
368 allowed_fragments = [1]
369 settings['allowed_fragments'] = allowed_fragments
371 accessWrapper = DataAccessWrapper(settings)
372 seqInfo = SeqSpliceInfo(accessWrapper,settings['allowed_fragments'])
374 #lt1 = None
375 lt1 = LookupTable(settings)
377 print 'Checking with toy data...'
378 simple_check(settings,seqInfo,lt1)
380 settings = {}
382 settings['genome_dir'] = '/fml/ag-raetsch/share/projects/genomes/A_thaliana_best/genome'
383 settings['acceptor_scores_loc'] = '/fml/ag-raetsch/home/fabio/tmp/interval_query_files/acc'
384 settings['donor_scores_loc'] = '/fml/ag-raetsch/home/fabio/tmp/interval_query_files/don'
386 settings['genome_file_fmt'] = 'chr%d.dna.flat'
387 settings['splice_score_file_fmt']= 'contig_%d%s'
389 allowed_fragments = [1]
390 settings['allowed_fragments'] = allowed_fragments
392 accessWrapper = DataAccessWrapper(settings)
393 seqInfo = SeqSpliceInfo(accessWrapper,settings['allowed_fragments'])
395 lt1 = None
396 #lt1 = LookupTable(settings)
398 #print 'Checking with real data...'
399 #simple_check(settings,seqInfo,lt1)
402 def run():
403 print 'Creating some artifical data...'
404 create_mini_chromosome()
405 print 'Performing some checks...'
406 checks()
408 if __name__ == '__main__':
409 run()
410 #check_createScoresForSequence()
411 #suite = unittest.TestLoader().loadTestsFromTestCase(TestQPalmaPrediction)
412 #unittest.TextTestRunner(verbosity=2).run(suite)