[qpalma.git] / tests / test_qpalma.py
1 #!/usr/bin/env python
2 # -*- coding: utf-8 -*-
4 # This program is free software; you can redistribute it and/or modify
5 # it under the terms of the GNU General Public License as published by
6 # the Free Software Foundation; either version 2 of the License, or
7 # (at your option) any later version.
8 #
9 # Written (W) 2008 Fabio De Bona
10 # Copyright (C) 2008 Max-Planck-Society
13 import cPickle
14 import random
15 import sys
16 import math
17 import numpy
18 from numpy import inf
19 import os.path
20 import shutil
21 import pdb
22 import array
23 import unittest
25 from qpalma.qpalma_main import QPalma,preprocessExample
26 from qpalma.utils import print_prediction
28 from qpalma.Run import Run
30 from qpalma.SettingsParser import parseSettings
31 from qpalma.DatasetUtils import processQuality
32 from qpalma.OutputFormat import alignment_reconstruct
33 from qpalma.sequence_utils import DataAccessWrapper,SeqSpliceInfo
35 from qpalma.Lookup import LookupTable
37 jp = os.path.join
40 def createTrainingSet():
42 dataset = {}
44 id = 1111
45 chromo = 1
46 strand = '+'
47 up_cut = 117
48 down_cut = 383
50 currentSeqInfo = (id,chromo,strand,up_cut,down_cut)
52 # tcaatacaaatcctatttcttgtggttttctttccttcacttagctatggatggtttatcttcattt
53 # tcaatacaaatcctatttctt ctatggatggtttatcttcattt
55 originalRead = 'tcaatacaaatcctatttcttctatggatggtttatcttcattt'
56 raw_qualities = 'h'*len(originalRead)
57 prb_offset = 64
58 quality_interval = (-5,40)
59 perform_checks = True
60 quality = processQuality(raw_qualities,prb_offset,quality_interval,perform_checks)
61 currentQualities = [quality]
63 exons = numpy.mat([217,238,261,284]).reshape((2,2))
65 dataset[id] = (currentSeqInfo,originalRead,currentQualities,exons)
67 id = 2222
68 up_cut = 1560
69 down_cut = 1901
71 currentSeqInfo = (id,chromo,strand,up_cut,down_cut)
73 # tcctttaagattttgtttttataatgtgttcttccatccacatctatctccatatgatatggaccatatcatacatcatcatttgtccaaatgcatgaatgaatttggaaataggtacgagaatgccaacaatgacaagaa
74 # tcctttaagattttgtttttataatgt gtacgagaatgccaacaatgacaagaa
76 originalRead = 'tcctttaagattttgtttttataatgtgtacgagaatgccaacaatgacaagaa'
77 raw_qualities = 'h'*len(originalRead)
78 prb_offset = 64
79 quality_interval = (-5,40)
80 perform_checks = True
81 quality = processQuality(raw_qualities,prb_offset,quality_interval,perform_checks)
82 currentQualities = [quality]
84 exons = numpy.mat([1660,1687,1774,1801]).reshape((2,2))
86 #dataset[id] = (currentSeqInfo,originalRead,currentQualities,exons)
88 return dataset
91 def createPredictionSet():
93 dataset = {}
95 id = 1111
96 chromo = 1
97 strand = '+'
98 up_cut = 117
99 down_cut = 383
101 currentSeqInfo = (id,chromo,strand,up_cut,down_cut)
103 # tcaatacaaatcctatttcttgtggttttctttccttcacttagctatggatggtttatcttcattt
104 # tcaatacaaatcctatttctt ctatggatggtttatcttcattt
106 originalRead = 'tcaatacaaatcctatttcttctatggatggtttatcttcattt'
107 raw_qualities = 'h'*len(originalRead)
108 prb_offset = 64
109 quality_interval = (-5,40)
110 perform_checks = True
111 quality = processQuality(raw_qualities,prb_offset,quality_interval,perform_checks)
112 currentQualities = [quality]
114 exons = numpy.mat([217,238,261,284]).reshape((2,2))
116 dataset.setdefault(id, []).append((currentSeqInfo,originalRead,currentQualities))
118 id = 2222
119 up_cut = 1560
120 down_cut = 1901
122 currentSeqInfo = (id,chromo,strand,up_cut,down_cut)
124 # tcctttaagattttgtttttataatgtgttcttccatccacatctatctccatatgatatggaccatatcatacatcatcatttgtccaaatgcatgaatgaatttggaaataggtacgagaatgccaacaatgacaagaa
125 # tcctttaagattttgtttttataatgt gtacgagaatgccaacaatgacaagaa
127 originalRead = 'tcctttaagattttgtttttataatgtgtacgagaatgccaacaatgacaagaa'
128 raw_qualities = 'h'*len(originalRead)
129 prb_offset = 64
130 quality_interval = (-5,40)
131 perform_checks = True
132 quality = processQuality(raw_qualities,prb_offset,quality_interval,perform_checks)
133 currentQualities = [quality]
135 exons = numpy.mat([1660,1687,1774,1801]).reshape((2,2))
137 dataset.setdefault(id, []).append((currentSeqInfo,originalRead,currentQualities))
140 return dataset
143 class TestQPalmaTraining(unittest.TestCase):
144 """
145 """
147 def setUp(self):
148 dir = '/fml/ag-raetsch/home/fabio/tmp/sandbox/testcases'
149 if os.path.exists(dir):
150 shutil.rmtree(dir)
151 os.mkdir(dir)
153 self.settings = parseSettings('train_testcase.conf')
155 accessWrapper = DataAccessWrapper(self.settings)
156 self.seqInfo = SeqSpliceInfo(accessWrapper,self.settings['allowed_fragments'])
158 self.training_set = createTrainingSet()
161 def testInitialization(self):
162 pass
165 def _test_preprocessExample(self):
166 """
167 """
169 id = 2222
170 (currentSeqInfo,originalRead,currentQualities,exons) = self.training_set[id]
171 print originalRead
173 try:
174 preprocessExample(self.training_set,id,self.seqInfo,self.settings)
175 except:
176 print sys.exc_info()
179 def _test_performAlignment(self):
180 """
181 """
182 #performAlignment(dna,read,quality,mmatrix,donor,acceptor,ps,qualityPlifs,current_num_path,prediction_mode,settings)
183 pass
186 def test_train(self):
187 """
188 This function
189 """
191 set_name = 'test_train'
193 qp = QPalma(self.seqInfo,True)
194 qp.train(self.training_set,self.settings,set_name)
198 class TestQPalmaPrediction(unittest.TestCase):
199 """
200 This class...
201 """
204 def setUp(self):
205 """
206 """
208 dir = '/fml/ag-raetsch/home/fabio/tmp/sandbox/testcases'
209 if os.path.exists(dir):
210 shutil.rmtree(dir)
211 os.mkdir(dir)
213 self.settings = parseSettings('train_testcase.conf')
215 accessWrapper = DataAccessWrapper(self.settings)
216 self.seqInfo = SeqSpliceInfo(accessWrapper,self.settings['allowed_fragments'])
218 self.prediction_set = createPredictionSet()
221 def test_predictionFromTrainedParameters(self):
222 self.prediction_set
224 qp = QPalma(self.seqInfo,True)
226 self.settings['prediction_param_fn'] = 'param_0.pickle'
228 allPredictions = qp.predict(self.prediction_set,self.settings)
230 for current_prediction in allPredictions:
231 align_str = print_prediction(current_prediction)
232 print align_str
234 id = current_prediction['id']
235 seq = current_prediction['read']
236 dna = current_prediction['dna']
237 chromo = current_prediction['chr']
238 strand = current_prediction['strand']
239 start_pos = current_prediction['start_pos']
240 predExons = current_prediction['predExons']
242 numExons = int(math.ceil(len(predExons) / 2))
244 print alignment_reconstruct(current_prediction,numExons)
245 print id,start_pos,predExons
247 ## chr1 + 20-120
248 #read = 'catctatgcaacagcattacagtgatcaccggcccaaaaaacctgtgtctggggttttgcctgatgatagcagtgatactgaaactggatcaatggtaag'
249 #currentQualities = [[40]*len(read)]
251 #id = 3
252 #chromo = 1
253 #strand = '+'
255 #genomicSeq_start = 3500
256 #genomicSeq_stop = 6500
257 #print 'Position: ',
258 #print genomicSeq_start,genomicSeq_stop
260 #currentSeqInfo = id,chromo,strand,genomicSeq_start,genomicSeq_stop
262 #example = (currentSeqInfo,read,currentQualities)
263 #self.prediction_set[id] = [example]
265 ## chr1 - 5000-5100
266 #read = 'ctgtgtatctggttgctcaatatgctcgccggaaaatgaagatcatggatgctgtgagttctccttattgttcattatcaaactgatatgagtttctgat'
267 #currentQualities = [[40]*len(read)]
269 #id = 4
270 #chromo = 1
271 #strand = '-'
273 #total_size = 30432563
275 #genomicSeq_start = total_size - 6500
276 #genomicSeq_stop = total_size - 3500
277 #print 'Position: ',
278 #print genomicSeq_start,genomicSeq_stop
280 #currentSeqInfo = id,chromo,strand,genomicSeq_start,genomicSeq_stop
282 #example = (currentSeqInfo,read,currentQualities)
283 #self.prediction_set[id] = [example]
286 def _testAlignments(self):
288 settings = parseSettings('testcase.conf')
290 print self.prediction_set
291 for example_key in self.prediction_set.keys():
292 print 'Current example %d' % example_key
294 for example in self.prediction_set[example_key]:
295 print example
296 print 'size'
297 print len(example)
299 accessWrapper = DataAccessWrapper(settings)
300 seqInfo = SeqSpliceInfo(accessWrapper,settings['allowed_fragments'])
302 qp = QPalma(seqInfo,True)
303 allPredictions = qp.predict(self.prediction_set,settings)
305 for current_prediction in allPredictions:
306 align_str = print_prediction(current_prediction)
307 print align_str
309 id = current_prediction['id']
310 seq = current_prediction['read']
311 dna = current_prediction['dna']
312 chromo = current_prediction['chr']
313 strand = current_prediction['strand']
314 start_pos = current_prediction['start_pos']
315 predExons = current_prediction['predExons']
317 numExons = int(math.ceil(len(predExons) / 2))
319 print alignment_reconstruct(current_prediction,numExons)
320 print id,start_pos,predExons
322 print 'Problem counter is %d' % qp.problem_ctr
327 def _testAlignments(self):
328 run_dir = '/fml/ag-raetsch/home/fabio/tmp/newest_run/alignment/saved_run'
330 run = cPickle.load(open(jp(run_dir,'run_obj.pickle')))
331 run['name'] = 'test_run'
332 run['result_dir'] = '/fml/ag-raetsch/home/fabio/tmp/sandbox/testcases'
334 param_fn = jp(run_dir,'param_526.pickle')
335 param = cPickle.load(open(param_fn))
337 print self.prediction_set
338 for example_key in self.prediction_set.keys():
339 print 'Current example %d' % example_key
341 for example in self.prediction_set[example_key]:
342 print example
343 print 'size'
344 print len(example)
346 # fetch the data needed
347 settings = {}
349 settings['genome_dir'] = '/fml/ag-raetsch/share/projects/genomes/A_thaliana_best/genome'
350 settings['acceptor_scores_loc'] = '/fml/ag-raetsch/home/fabio/tmp/interval_query_files/acc'
351 settings['donor_scores_loc'] = '/fml/ag-raetsch/home/fabio/tmp/interval_query_files/don'
353 settings['genome_file_fmt'] = 'chr%d.dna.flat'
354 settings['splice_score_file_fmt']= 'contig_%d%s'
356 allowed_fragments = [1]
357 settings['allowed_fragments'] = allowed_fragments
359 accessWrapper = DataAccessWrapper(settings)
360 seqInfo = SeqSpliceInfo(accessWrapper,allowed_fragments)
362 qp = QPalma(run,seqInfo,True)
363 allPredictions = qp.predict(self.prediction_set,param)
365 for current_prediction in allPredictions:
366 align_str = print_prediction(current_prediction)
367 print align_str
369 id = current_prediction['id']
370 seq = current_prediction['read']
371 dna = current_prediction['dna']
372 chromo = current_prediction['chr']
373 strand = current_prediction['strand']
374 start_pos = current_prediction['start_pos']
375 predExons = current_prediction['predExons']
377 numExons = int(math.ceil(len(predExons) / 2))
379 print alignment_reconstruct(current_prediction,numExons)
380 print id,start_pos,predExons
382 print 'Problem counter is %d' % qp.problem_ctr
385 if __name__ == '__main__':
386 train_suite = unittest.TestLoader().loadTestsFromTestCase(TestQPalmaTraining)
387 predict_suite = unittest.TestLoader().loadTestsFromTestCase(TestQPalmaPrediction)
388 all_suites = unittest.TestSuite([train_suite, predict_suite])
389 unittest.TextTestRunner(verbosity=2).run(all_suites)